StudentShare
Contact Us
Sign In / Sign Up for FREE
Search
Go to advanced search...
Free

Assignment 5, Biology - Essay Example

Cite this document
Summary
These exercises will help you understand and remember this information. Note that there is another file for this assignment (BSC1005_Ch05_Asnmt_IMAGES.pdf) which contains images of an animal and plant…
Download full paper File format: .doc, available for editing
GRAB THE BEST PAPER94.5% of users find it useful
Assignment 5, Biology
Read Text Preview

Extract of sample "Assignment 5, Biology"

Chapter 5. The Next Step: Eukaryotic Cells Chapter Assignment – Eukaryotic cell structure In Chapter 5, we discussed the structure and function of eukaryotic cells. These exercises will help you understand and remember this information. Note that there is another file for this assignment (BSC1005_Ch05_Asnmt_IMAGES.pdf) which contains images of an animal and plant cells. 1. Organelles. One characteristic of eukaryotic cells is that they contain organelles, which each have a specific structure and function.

Use your text, the Assignment 5 image file, and Internet or other resources to complete the table below to show details of the main organelles.OrganelleShapeFunctionNucleusRound, nuclear envelope, a double membrane, contains nucleoskeleton, genetic material and nucleolusControl centre, contains genetic material (DNA & RNA) responsible for the formation of various cellular proteins responsible to carryout diverse functions for metabolism and survival of the cell. Plays imperative role in cell division.

Porous nuclear membrane aids in transport of various componentsCell membraneElastic like lipid bilayer. Contains intrinsic and extrinsic proteins. Lipid is phospholipid with hydrophilic (water loving) and hydrophobic (water repelling) molecules.In animals it is the membrane separating internal cellular composition from the external environment, an osmotic membrane maintains osmotic gradient, protein molecules present in the membrane aids in transport of various substance. In plants it is protected by the outer cell membrane that retains the shape of the plasma membrane and prevents it from rupturing due to endosmosis.

MitochondrionAn oval double membrane organelle with inner membrane folded in the form of cristaeReleases energy (ATP) from the breakdown of organic molecules by performing TCA cycle or Krebs cycle. Present in both plants and animals. It is said to be evolved from the prokaryotic cell. ChloroplastOval organelle present only in plants.Contains chlorophyll and performs photosynthesis which is responsible for food for all the living organisms as well as produce oxygen which is essential for life.Endoplasmic reticulumLong elongated tubular structures.

With ribosomes attached on the surface they are RER; while those without ribosomes on the surface, SER.RER plays an imperative role in the formation of protein while SER are secretory structures which are responsible for secreting various juices fro the metabolism of the cell.VacuolePlant cell contain one or two big vacuole which contain cell sap. Vacuole are the characteristic feature of the plant cell. They contain cell sap and are responsible for the turgid condition of the plant cell, responsible for the erect position of plants.

Cell wallUsually rectangular. It surrounds the cell.Cell wall is the characteristic feature of the plant cell. It is responsible for rigidity to the plant. It is made up of cellulose. Plant cells are attached to each other by means of cell wall.CentriolesCharacteristic feature of the animal cell. Present as cylindrical bundles.Plays vital role in the cell division of animal cell.2. Animal and plant cells have similarities and differences. Use your text, the Assignment 5 image file to complete the Venn diagram below comparing both cell types:3.

You have compared the eukaryotic cell structure of animal and plant cells. Which of the other Kingdoms have eukaryotic cells? Using Internet sources and your text, find out how eukaryotic cells in these kingdoms differ from the plant and animal cells.Kingdom Fungi and Kingdom Protista also contain eukaryotic cells. Fungi are like plants as they are fixed and produce spores but they differ from plants in their mode of nutrition. Plants are multicellular prepare their food and are autotrophs, while fungi is also single or multicellular but is sparotroph.

Kingdom protista contain unicellular organisms which are microscopic and possess well defined nucleus. They use pseudopodium or cilia or flagella for locomotion instead of appendages as in animal kingdom.Works CitedAlberts, B., Dennis, B., Hopkin, K., Johnson, A. Lewis, J., Raff, M., Roberts, K., Walter, P. "Essential Cell Biology". Garland Science/ Taylor & Francis Group. 2nd Ed. 2003.

Read More
Cite this document
  • APA
  • MLA
  • CHICAGO
(“Assignment 5, Biology Essay Example | Topics and Well Written Essays - 250 words”, n.d.)
Assignment 5, Biology Essay Example | Topics and Well Written Essays - 250 words. Retrieved from https://studentshare.org/biology/1597652-assignment-5-biology
(Assignment 5, Biology Essay Example | Topics and Well Written Essays - 250 Words)
Assignment 5, Biology Essay Example | Topics and Well Written Essays - 250 Words. https://studentshare.org/biology/1597652-assignment-5-biology.
“Assignment 5, Biology Essay Example | Topics and Well Written Essays - 250 Words”, n.d. https://studentshare.org/biology/1597652-assignment-5-biology.
  • Cited: 0 times

CHECK THESE SAMPLES OF Assignment 5, Biology

Practical Issues in Bioinformatics

Subject: Health sciences and medicine, Assignment   Topic:  Bioinformatics; CW1 – Database Coursework Date: 26th October 2012 Partial DNA sequence for a gene that your company is interested in: CGGCGCCGCGAGCTTCTCCTCTCCTCACGACCGAGGCAGAGCAGTCATTATGGCGAACCTTGGCTGCTGGATGCTGGTTCTCTTTGTGGCCACATGGAGTGACCTGGGCCTCTGCAAGAAGCGCCCGAAGCCTGGAGGATGGAACACTGGGGGCAGCCGATACCCGGGGCAGGGCAGCCCTGGAGGCAACCGCTACCCACCTCAGGGCGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGG A short report telling them what data is publicly available for this gene....
6 Pages (1500 words) Assignment

The Theories Presented by Lawrence Kohlberg

However, it is only obvious that environment, cultures, and socialization have greater impact than biology ever could on defining gender roles Question 3 Not being able to remember things, simple things that should not be easy to forget has to be, both, frustrating and, a bit, frightening....
2 Pages (500 words) Assignment

Redesigning the Future

Many problems with students' understanding of, for example, biology or history come with the fact that they do not know why they are studying biology or history what biologists and historians attempt to accomplish through their scholarly endeavors.... The paper “Redesigning the Future” seeks to evaluate educational evaluation, which was significantly shaped by what nature, aims, and means of education are....
3 Pages (750 words) Assignment

Basic English Reading Skills

Student's Grouping: 26 students total (15 boys and 11 girls); 16 students are on-grade-level readers; 5 students are two grades below reading level (3 with identified learning disabilities in reading); 5 students are two grades above reading level (2 with identified gifted… ptionalities); 1 student is an English Language Learner (ELL) at the intermediate level; 3 students have been diagnosed with attention deficit hyperactivity disorder (ADHD) Broad objective: by the end of the lesson, the Students should be able to identify and categorize Lesson Plan al Affiliation A....
3 Pages (750 words) Assignment

The Top Polluter in the United States

The top two pollutants that this company produces are lead compounds at 2810060 pounds and Asbestos at 1912784 pounds. New York being biology Assignment The company Red Dog OPS is the top polluter in the United s, the company produces 481578816 pounds of toxic wastes to the environment....
1 Pages (250 words) Assignment

Biology of Aids and Stds

This work called "biology of Aids and Stds" describes a major pandemic HIV-1, ways of transmission.... The author takes into account the problem of HIV transmission, the way of solving it, various risks, the role of culture, the quality of life.... nbsp;… According to the Review article by Kourtis, et al, pediatric HIV-1 is still a major pandemic, despite the reductions in transmission from mother to child that have been achieved....
9 Pages (2250 words) Assignment

Biological Aspects of Personality and Types of Experiences

This assignment "Biological Aspects of Personality and Types of Experiences" focuses on the two ways in which our "biology" may influence the types of experiences we have and some of the problems encountered in trying to test a nervous-system-based theory of temperament.... nbsp;… This assignment also takes one element of the theories or ideas presented and applies it to a real person – for example, someone from current events, politics, business, sports, the entertainment field....
7 Pages (1750 words) Assignment

The Representation of Mosquitoes

This paper outlines that the mosquitoes reproduce excessive amounts of eggs that mature into adulthood.... These mosquitoes further reproduce an excessive amount of young across the subsequent generations.... nbsp; These offspring are in an abundant number to comfortably replace their parents....
3 Pages (750 words) Assignment
sponsored ads
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.
Contact Us